Announcement

Collapse
No announcement yet.

The Sherbie TrialI

Collapse

Google Ads

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • The Sherbie TrialI

    The Sherbie Trial has made it through 3 boards and has yet to be posted here yet; so in honor of Sherbie's 10 year anniversary for posting on ESPN I give you 'The Sherbie Trial'
    The judge: Swoonersteve44

    The plaintiffs: Sherbie (aka sherbs, the board whore) and Coles(aka JohnKRaymond's punching bag)
    Their attorney: jtrain17

    The defendents: MMG , Kbnole, secman, timb, gator
    Their defense team: 38Noles


    jtrain's case for his clients: "Your honor! I did not eat that doughnut!! Errr, sherbs is a good lady"

    38Noles's case for his clients: "Coles, we saw the damn boobies. My clients want refunds for a total of $324.79 for all their webcams they bought for her"


    38Noles: "We call Coles to the stand!!!. Now, Mr Coles, did sherbie not call secman on the night of december 19th, 2004 , describing how she'd go down on him via telephone? Did she not!!"
    jtrain17: "I object!!"
    Judge swoonersteve: "SILENCE!!!"
    jtrain17: "LMFAO at you. Completely and utterly jtrained!!"
    Coles: "Ugh, ugh, mother!!!!"
    38Noles: "That is all!"

    jtrain17: "Your honor! We call to the stand...sherbie!! Sherbie, is it true that you seduced these young men?"
    sherbie: "I love my Hoos!! Hooooooossss!!"
    jtrain17: "Any questions??? EXPOSED!!"

    38Noles: "We have 1 final witness your honor. We'd like to call COONASS to the stand!! COONASS, describe sherbies sexual powers"
    COONASSDH: "she even hit on me over AIM , and im gay!"
    38Noles: "Thank you!!"

    jtrain17: "Now COONASS, let me ask you this, you are wrong about everything else, how can we take you seriously??"
    COONASSDH: "obsess much?"
    jtrain17: "HAHA! EXPOSED!! I did not mean to insult your family, nor make you cry"
    swoonersteve44: "ENOUGH! I've had it with this shit! Fuck you, fuck you and fuck the rest of you. I'm done with this place, fuck all of you"

    **silence**

    Officer Bungerhole: "All rise. We've had an unfortunate 'incident'. I'd like to present to you our new judge..."
    **bursting through the doors**
    koolaid man: "Oh yeah!!!!"
    38Noles: "No! Judge, do you have any prior experience with the plaintiff?" Kool Aid: "OH YEAH!"
    38Noles: "Did she appear on webcam for you?"
    Kool Aid: "OH YEAH!"
    38Noles: "What did you talk about?"
    Kool Aid: "She said she wanted to drink from my spout. OH YEAH!"
    jtrain17: "Alright you fuckbags, enough of this shit. LMFAO at both of you cum-slinging god damned ignorant fucks!"
    Kool Aid: "Sit down fatass!! Oh yeah!!!"


    jtrain17: "We'd like to call our next witness...samnite!"
    Officer Bungerhole: "Do you swear to tell the truth, the whole truth, and nothing but the truth..so help you Tebow?"
    samnite: **confused smilie**
    jtrain17: "Alright sammy boy, tell us all you know about sex"
    samnite: **confused smilie** "Umm, alright?"
    jtrain17: "Huh, come again fuckbag?"
    samnite: "I think the courtroom typist spelled alright wrong. A-L-R-I-G-H-T."
    jtrain17: "For fuck sakes..."

    38noles: "Your honor, we have 1 last witness, I promise!!"
    koolaid man: "Oh yeah? OH YEAH!!!"
    38 noles: "We call to the stand..GENO!!. Geno, describe your relations with sherbs"
    GENO: "Listen kid..don't you ask me about sex until you surpass my greatness, got it?"
    38noles: "Ooookkkkkaaaayyy...."
    GENO: "I e-fucked sherbie before any of y'all were ever on the board. im the defending 3 time e-fucking champion"
    38noles: "Well it seems sherbie has done a lot of fucking"
    GENO: "Your e-condoms are not made of the same latex as my Trojan"
    38noles: "Thank you Geno"
    GENO: "Oh, shove it asswhipe..."

    jtrain17: "Your honor, we call KBNole to the stand"
    **Loud noises** (Camera points to KBnole sitting on his stool with sherbie emerging from underneath)
    sherbie: "Uhh mm, the Eagles game is on, catch ya later!!"
    jtrain17: "So tell me KB, I want ANSWERS!!! My client is a virgin and SO ARE YOU!!"
    KBNole: "Mm....."

    **Loud banging noise**

    Mystery voice: "I have the answers you are looking for"

    **Hooded man with his face hidden enters the room**

    38Noles: "Who the fuck are you?"
    Mystery man: "The name is FootballFan kid, show some respect."

    **Loud slurping noise in the background**

    38Noles: "Oh my god! Someone drank Koolaidman!!!"
    jtrain17: "Uhhhh, i'll be back in 5!!"

    (5 minutes later)

    jtrain17: "I just pissed excellence!!! As always, enjoy it!!"
    FootballFan: "Listen up my intellectual inferiors, I have the answers you need"
    jtrain17: "Oh shove it GENO"
    FootballFan: "Who is this GENO you speak of?
    (Timb races towards FootballFan and rips of the hoodie to expose...GENO!)
    Officer bungerhole: "You are banned from this courtroom. Cya!"

    jtrain17: "Anyways...Back to the task at hand. Kb, you are a virgin and so is Sherbie!! Admit it!!"
    KBNole: "Listen here fatass, just because you haven't had a legitimate sexual partner in nearly 40 days, doesn't mean we all haven't either. I've had more sex in the last 25 days then any of you fucks. LOL at your bogus condom pre-ejaculation of 5 days ago"
    jtrain17: "LMFAO at you thinking sex was invented 25 days ago. Kiddo, the big boys have been having sex for a 100 days now, and unlike any of you, i'm getting some more tonight. The jtraineth jizzsaw marches on!!!"

    **worldofx rises**

    waldo: "LMFAO at both of you. I will be having sex tonight, not you. I've had sex 3 times in the last 4 nights. I've got a 5 star cock. I'm a dynasty, a dynasty bitches!!"
    COONASSDH: "LMFAO at all 3 of you. Call me when you've been with as many wo(men) as I have"
    Everyone in unison: "SHUT THE FUCK UP COON!!!"
    COONASSDH: "Completely COONowned and it wasn't even close"
    waldo: "Speaking of which, COON and me both shared a sexual partner 3 nights ago"
    half naked HS recruit: **big grin smilie** "Now this I can attest too"
    MrMichiganGuy: "LMFAO at all of you. I'm the most sexually experienced person in this courtroom."
    jtrain17: "LMFAO at you not having sex in 58 days. Hail to the Penis!!!"
    MrMichiganGuy: "Umm, try 9 nights ago??"

    **MarineHusker stands up**

    MarineHusker: (gnarls like an angry dog) "You shut the fuck up okay..That was me who had sex 9 days ago. (Walks over and e-punches MMG )
    Timb: "ENOUGH!! This is out of hand!"
    Officer Bungerhole: "Agreed. I will take over as judge of this trial, enough of this nonsense. Let's be professional here"
    **bungerhole rips off his uniform to reveal a batman costume**

    Bungerhole: "Alright 38noles, I will give you 1 last witness"
    38noles: "Your honor, we call.......Michael Gaydos to the stand!!!"

    (To be continued)



    38Noles: “Okay Gaydos, tell us what you….”
    Hornsfan21: “Wait, let me ask sherbie a question”
    38Noles: “Umm, that isn’t how it works here”
    Hornsfan21: “asdflsafdlsandfsa, Fuck you”
    Coles: “Can somebody please tell the jew to shut up?”

    **Loud bird noises heard in the background**

    Diry old bum: “Sure. Hey gaydos, Shut the fuck up!! Give me back my slut!!”
    Hornsfan21: “Hey back off man. I’m trying to mind my own business here. Don’t call her a slut okay. She said I was cute a year ago. Sherbie said she liked men who couldn't get into a real college. Gooooo Roadrunners!! sdfasndflnkladsnfasfd”
    MrMichiganGuy: “I have a complaint. Can we please hurry this up?”
    Worldofx: “Yeah, no shit. Laguna Beach starts soon”
    38Noles: “Hey wait a second. Is it me or does that bum look like Lamar Thomas? Hmm…”
    Diry old bum: “Nobody but nobody walks into the C.R. without stuffing their dick in sherbie’s bungerhole.”

    **Bum pulls out a knife**
    hornsfan21: “Oh oh. Sadflnsadflksandflsandflnsadf.”
    **The gaydos Gestapo bursts into the court room**

    hornsfan21: “Haha! Who’s got the upper hand now”
    **Bum turns toward the crowd and flashes the [__]. HurricaneReuben, CanesDude, TheU, readysetdominate get up and take a charge at the gaydos Gestapo swinging pens wildly**

    Diry old bum: “Nobody walks into our house and pushes us around” (Stomps on gaydos’ head multiple times as Avery Johnson’s man juice seeps out of gaydos’ mouth)

    COONASSDH: “Uhh, I think he’s dead”
    Jtrain: “No shit, really? What’s next, you’re going to tell us you love penis??”
    38Noles: “ Auschwitz comes to mind”
    JohnnyRebel: “He’s dead? BAM!”
    Timb: “This shit is out of hand!!”
    MrMichiganGuy: “Motion to move this trial elsewhere. Also, can someone please get me some whine?”

    **hf21’s corpse is dragged out of the courtroom while HurricaneReuben slips the bum a $50. **

    secman: “I don’t know about you guys but, i’m not very flaccid anymore. Holy crap! War Damn Penis!!”
    38Noles: “Whoa!! Wait!!!”
    **38Noles runs towards secman and whispers something into his ear**
    38Noles: “Your holy bungerness, we have some new evidence!!! If the dick don’t fit, you must acquit. Let’s find out, shall we….”

    38noles: “Alright, take off those orange pants. Sherbie, bring those big ass DSL ’s over here”
    jtrain17: “I object!!”
    bungerhole: “Silence fatboy!! 38Noles, please continue”

    **sherbie walks over towards the pant-less secman**

    COONASSDH: “Look at the size of it!! That would make an elephant jealous”
    Hippieki11er: “*It = your length, boss?” **lol smilie**
    Worlofx: “wow” (unzips his pants and closes his eyes) “Picture Rey-Rey, picture Rey-Rey!!. Awa Awa Awaaaaaaaluuuuuuuuuugggggaaaaaaaa”
    Bamaboybignate: “Pssh, that’s nothing. Got 12?”
    Princetonfootballfan: (Rolling on the floor laughing his fucking ass off) “Got 24? Didn’t think so”

    **silence**

  • #2
    secman: “We’re having a tough time here. It won’t fit”
    38Noles: “Yes!!”
    jtrain17: “For fuck sakes, open those lips you ugly whore”

    **Loud girlish scream heard from outside the building**

    Potsy: “Help!!!! Ahhhhhhhhhh”
    Bungerhole: “Robin? I’ll save you!!!!”
    Timb: “Shit is out of hand!!”

    **bungerhole jumps from his seat and jumps out the window**

    Jtrain17: “LMFAO at that penis loving assclown bungerhole”

    **COONASSDH pulls out a digital camera and points it towards himself**

    COONASSDH: “H#ll yes. A new glamour shot to send to all the ladies”
    Timb: “Shut the fuck up you queer”
    COONASSDH: “obsess much?”
    Timb: “I’ve had enough of you. As the most important person left here, I banish you from the CR”
    COONASSDH: “English motherf#$ker, you speak it?”
    Timb: “Get the fuck out!!!”

    **Phone ringing in the background**
    Timb: “Hello? Excellent. Okay, see you in a minute”. (puts phone down) “Okay guys, our new judge should be here any second now”

    Jtrain17: “Baby, how did it not fit?”
    Sherbie: “I don’t know” (crying). “It’s over. We’ve lost”
    Jtrain17: “LMFAO at your ignorant ass!! It ain’t over till jtraineth says so. Time for plan B”
    Sherbie: “No jtrain, there won’t be a plan B. Grant!!!”

    **grantduck runs towards sherbie**

    grantduck: “Yesss!”
    jtrain17: “LMFAO at your ignorant asses. Nobody walks into a trial in the middle of the night and defeates the jtraineth jizzsaw”
    grantduck: “Move over buddy. I got this in control”
    jtrain17: “Alright. Sherbs, since I love you, I will back away. If this man can get you out of this mess, I will leave your life forever”

    **jtrain waddles over into the crowd**

    grantduck: “Okay sherbs. I got this all under control”

    **Backdoor swings wide open. The new judge is….the Oregon replay official!!**

    Timb: “Fuck no!! You?? I hope your family dies you worthless cockroach.”
    OregonReplayOfficial: “Silence!! I have all the power now. Muwahahahaahhaahaha”
    Timb: “Fuck you!! I’m going to send 3000 emails to your superiors! You will never judge again!!”

    **Timb jots something down on his notepad, runs out the room, heads towards the photocopier and prints out 50,000 “He hate me” articles**

    OregonReplayOfficial: “Alright, after reviewing this case, the defense team did not have enough evidence to acquit secman. The trial goes on!!”

    38Noles: “Huuuuuuuuuuuuh? Is this a joke??”
    **grantduck smiles as the crowd is absolutely silent**

    grantduck: “Boy, sure is quiet in here now”
    jtrain17: “Yeah, about as quiet as Autzen on a Saturday you assclown”

    grantduck: “HEY!! I’m a respectable attorney…….

    **20 minutes later**

    grantduck: “…..the defense office zoo….”

    **20 minutes later**

    grantduck: “…you ignorant jackass”
    jtrain: “HAHAHAHAHAHAHAHAHA”
    grantduck: “Hey fatboy. I just won the trial. Looks like your e-sex with sherbs is over.”

    **Bungerhole, with Potsy dangling from his cock, crashes through the back window**

    Bungerhole: “Not soo fast!!!” (Turns towards OregonReplayOfficial) “Thanks, i’ll take over from here.” (Turns towards grantduck and jtrain17) “Enough bickering. Grantduck, you just wasted 45 minutes of my time with that tirade, you uptight fuck”

    Grantduck: (steam coming out of his ears) “Fuck this. Sherbie, i’m done”
    38Noles: “Haha!!”
    Bungerhole: “I will allow jtrain to return as sherbie’s attorney as long as the court typist puts your words down in the name of bungertrain”
    Bungertrain: “Deal. Congrats asshats!!”
    38Noles: “LMFAO at this welcher.”
    Bungerhole: “Silence!!! Bungertrain, do you have any further witnesses?”
    Bungertrain: “Yes, why yes we do!!! We call, the sexually frustrated, 40 year old virgin, minimure to the stand!!!”

    Crowd in unison: “Shitty!! Shitty!! Shitty!! Shitty!!”

    Bungerhole: “Just wait. Since I was away, i’d like to see the transcript please.”

    Samnite: “Can we have the transcript from the last week read back?”

    LSUBlondie: “There's like, too many big words in there.”


    **Fresneckistani, the court typist, hands bungerhole the script**

    Bungerhole: “Huh? WTF? Fresneck, all I see here is random garbage about some division 1-aa school in California . I don’t care about that shit. Alright, mini, how’s the warcraft game coming along?”
    MrMichiganGuy: “I e-owned his shitty ass”

    Crowd in unison: “Shitty!! Shitty!! Shitty!! Shitty!!”

    Minimure: “Hey, it’s not my fault i’m shitty. People are born shitty”
    Bungertrain17: “Exactly! That’s why your mother should’ve aborted your ignorant fucking ass A LONG time ago!!!”
    Minimure: “Umm okay but, do you have a question about sherbs?”
    Bungertrain17: “What the fuck? No you ignorant fool. We all know you’d never get any. Infact, get off my stand you faggot assed bitch”

    Bungerhole: “Alright 38noles, unless you have something to add, bring out your next witness”

    **Timb rushes in**

    Timb: “Alright, it has come to my attention that these lawyers are way out of hand!! From now on, there will be a strict limit on your speech. A maximum of 2 characters shall be permitted in your speeches. Thanks for your time.”

    **Timb rushes out and heads back to the photocopier**

    38noles: “Your honor, we call Gaytor to the stand. BTW, LMFAO at you getting sloppy seconds with that bitch 10 days ago and claiming you took her virginity.”

    Gator: “Congratulations on getting her in your own house earlier that day. I finished her off on a neutral site that night. I’m the e-fucking champion of 10 days ago!!”

    38noles: “No no no!! I’m the e-fucking champion of 10 days ago!!”

    **Mystery person storms into the room**
    Mysteryman: “No!!!!!! I AM the defending 34 time e-fucking champion”

    bungerhole: “Who are you”

    Mysteryman: “The name is Diablo. Again, show some respect kid…errr”

    Bungerhole: “GENO!! You coward!! You were banished”

    GENO: “Fuck you bunger. I just finished cleaning up all the human skulls from my backyard.”

    **tiny man rises from the back**

    dawgtail: “Fvck you dumb $chitt.”

    GENO: “Yeah? Come say that to my face you piece of shit”

    Gator: “Human skulls in a backyard??? What is this, The Pit?”

    bungertrain17: “Hey back off Gene. You can’t talk to my brother like that”

    **audience gasps**

    bungertrain17: “Yes, dawgtail is my long lost brother. We are very different though! Our mother gave him the brains and me the lardass”

    GENO: “Don’t fuck with me Josh, I’m warning you”

    **2 men in the back finish “up” 69 style and walk towards the front**

    Rico: (Towards GENO) “Hey pissface”
    MarineHusker: “Fuck you Gene…..”

    Rico: “Alright, who’s got cancer here? Whoever it is, I hope you die”

    GENO: “Fuck the lot of you. You are all cowards.”

    **E-brawl breaks out**
    **COONASSDH enters room in tears**
    Bungerhole: “Wait a second, weren’t you banished from here? You know what, I don’t want those liberal fucks after me again for bigotry. You can stay homeaux”
    COONASSDH: “Pratel this brawl?? Everyone against GENO? Typical home cookin’ in the CR”
    Bungertrain17: “Get out of my room you cum juggling hick”
    COONASSDH: “Fine with me. I’m going to greyhound over to Tennessee ”

    **COONASS leaves the room**

    Comment


    • #3
      **brawl stops. Dead silence for 30 seconds**

      **Beowulf rises**
      Beowulf: “The judge is killing Sherbie with all these cheap calls, it's a conspiracy, but I don't really care because I'm a Gameday fan”
      MrMichiganGuy: “Can I get another glass of whine please?” (Points to the delivery guy) “And I want YOU to get me a ritz cracker ASAP”

      **sickemsmokey rushes in and takes a picture of MMG eating a cracker**

      MrMichiganGuy: “Hey!! Fuck that! Gimme that camera!!”

      ** MMG takes camera and smashes it**

      **timb rushes in**
      Timb: “This shit is out of hand!!!”
      **timb rushes back out**

      38Noles: “Oohhhhhkkkkaaaaaay. Anyways, Gator, tell us about sherbie”
      Gator: “Well, the whore with the DSL ’s promised to meet me in Atlanta a few years back. She said she wanted to chomp on my dick and then begain to flop boobies2.jpeg at me”
      38Noles: “Yeah no shit gaytour. We’ve seen the damn boobies”
      Gator: “Then she said im done with the board/internet for a while. Don’t call me, I’ll call you."
      38Noles: “Thanks jackass!!”
      bungerhole: “Now before we go anywhere, since i’m an incompetent fool, I think it’s about time to reveal the jury to you all. From left to right, twolves, beamer4prez, ibleed, and rolltide”

      38noles: “umm, that’s only 4”
      bungerhole: “Well when they said get 12, I thought they were talking about ‘it’. I measured and got 4”
      Hippieki11er: “OH DEAR ” **lol similie**

      Twolves: “Hey peeps!! I’m a 21 year old college girl from Florida . I love you Brasky!!!”

      Beamer4prez: “Hey guys. I’m the most irrelevant person in this courtroom”

      **old man rises in the back**
      reblgent: “Go Hokies!!”

      twolves: “Uhh, shut up. I wasn’t finished here. Well anyways, I think sherbie is a dirty whore”

      **crowd is in shock**

      twolves: “I mean, what kind of girl wears an Eagles thong?”

      kbnole: “Fuck you bitch”

      twolves: (starts stripping) “Hey look I've got boobs and I'm at a football message board trial pay attention to meeeeee!"

      bungertrain17: “Holy hell!!! She’s not 18. LAWSUIT!!”

      **timb enters room**

      Timb: “shit is out of hand!!”

      **timb leaves room**

      Rolltide: “tessa I thought I was the special one???? Put your clothes back on!!"

      **Young man with a goatee rises**

      Gyle: “You are special. Yeah, a special retard”

      Rolltide: “Shut up Gyle. Don’t make me bite you with my fangs”

      Ibleed: “Excuse meeeeee?? Fangs?? I’m Master Splinter”

      Beamer4prez: “The hell you are, i’m Master Splinter”

      Rolltide: “Take him, I don’t care. I got dibbs on Leonardo”

      Twolves (puts clothes back on) “Nah ah ah ah, I’m Leonardo”

      Bunger: “You idiot. Master Splinter died in edition 2392 volume 14.”

      Rolltide: “I don’t care. Anways, I’ve got a question for the plaintiff. How do you think you will possibly be the trial whore next year with soonerbrat gone?”

      Gyle: (Laughing his fucking ass off) “Hey retard, soonerbrat hasn’t been here the last year either”

      **Everyone laughs at rolltide**

      **COONASSDH enters room with tears flowing down his cheeks**

      COONASSDH: “WAAAAHHHH WAAAAAHHHH”
      Bungertrain17: “Oh great, looks like someone needs penis”
      Bungerhole: “What’s wrong coonass?”
      COONASSDH: “Well……”

      Bungertrain17: “Oh for fuck sakes, someone give him a penis already. Where’s waldo when you need him??”
      COONASSDH: “I waited for 4 hours for him”
      Bungertrain17: “Him? HAHAHAHA EXPOSED!!!”
      COONASSDH: “Waited 4 hours for her. Don’t think I was pratel in the right city”
      Bungerhole: “Umm, can we get a Louisiana translator here??”

      **Merciful hick rises**
      Rusty/TLW: “Well, he trying to say girl no tell him right town to sex visit”
      Bungertrain17: “LMFAO at the geaux fraud nation. So let me get this right, you cum slinging penis loving fuck. You took a bus to go get laid?? HAHAHA”
      COONASSDH: “LSU. We take that much more bus sex trips to Tennessee then you”

      **timb enters room**

      Timb: “Shit is out of hand!!”

      **timb storms out**

      bungerhole: “Joshua, who is your next witness?”

      bungertrain17: “We call TTURedRaider and his stupid Texican ass to the stand!!. TTU, tell me your thoughts on sherbie?? Tell us how innocent she is!!”

      TTURedRaider: “We’ve established a great relationship over the years. We’ve had some pleasant kids come in like Kliff Kingsbury for example”

      Bungertrain17: (shakes head) “Great!!! Now here’s an idea fuckbag, how bout telling us about sherbie?”

      TTURedRaider: “Cody Hodges really elevated his game last year. Fine young QB. Oh yeah, and don’t forget B.J. Symons”

      Bungertrain17: “Good fucking god….”

      TTURedRaider: “I love Taurean Henderson”

      Bungertrain17: “You see your honor, it’s kids like this why we need the Jtrained nation”(Turns to TTU) “They should’ve sterilized your fathers stupid ass!!”

      TTURedRaider: “Hey fuck you!! My dad is the greatest man in the world. Leave him out of this”

      **Man stands up**

      Mike Leach: “Shh, son. We’ve been through this. Always let the fat man have the last word”

      TTURedRaider: “Dad!!! I thought I’d never see [__] again!!!”

      Mike Leach: “Son, I couldn’t leave you.”

      TTURedRaider: (sheds a tear) “Your honor may I be excused?”

      Bungerhole: “Sure”

      **TTURedRaider jumps off the stand, gets on top of that faggot-ass horse soapstuds with Mike Leach and rides off into the sunset**

      Bungerhole: “38noles, you’re up”

      38noles: “We call skelsa to the stand!!”

      **mt33 passes out**

      skelsa: “Huh? Me?? I’m innocent!!”

      38noles: “So skelsa, all are female internet posters complete e-sluts?”

      skelsa: “Excuse me?”

      38noles: “Just answer the question”

      skelsa: “Absolutely not!!”

      **COONASS breathes heavily with sweat dripping down his make-up covered face**

      38noles: “Laughable at best sweetheart!! You’re an e-slut too, aren’t you!!”

      **Awesome looking man rises**

      silky_johnson: “Nobody but nobody walks into the home of a female SEC fans house and gets laid!!”

      Rolltide: (laughs out loud)

      38noles: “Whatcha you laughing at retard??”

      Rolltide: “I fucked her!”

      Gyle: “We know that no woman wants to fuck a Forest Gump retard like you, just like nobody wants to coach at Alabama .”

      COONASSDH: “Well I phone fucker her and i’m gay!!”

      Skelsa: “Settle down boys!! PLEASE!!”

      **Brandy enters room**

      Brandy: “My fatass needs some pump’n”

      Rusty: “Damn holy hell pump that shit anyday me pumping like the ol’e day in Louisiana with them boys in school and all”

      Skelsa: “I’m innocent!!!”

      38noles: “Are you or are you the next sherbie??”

      **stupid-ass man rises**

      Pawprint: “Leave her alone you jackass” (To Skelsa) “Hey sweetheart” **icon big grin**

      Skelsa: “Hey sweety pie!!!”

      COONASSDH: “What pratel this? I thought I was sweetypie?”

      Pawprint: “Shut the fuck up flipper, don’t make me e-kick your ass”

      COONASSDH: “Ladd, please don’t. I just got a manicure yesterday”

      **Pawprint rolls up his sleeves but, a mysterious man rises from the back**

      COONASS’s cousin: “Hey Ladd, good ol’e buddy!! Long time no see”

      Pawprint: (pissing his pants in fear) “Uh, hey…”

      **COONASS’s cousin proceeds to beat the living shit out of pawprint**

      **mt33 gets up**

      Skelsa: (Crying) “I’ll never e-date another man again!!!”

      **mt33 passes out again**

      **timb enters room**

      Timb: “Shit is in my hand!!”

      **timb leaves room**

      MrMichiganGuy: “Mm, goddamnit I love Ritz!!”

      Okiepat2000: “link? OP”

      **twolves rises**

      Twolves: “Look at me!! Look at me!! I have boobies!!”

      Bungertrain17: “LAWSUIT!! She’s underage!!”

      **Pedophile enters room**

      Marcus Vick: “Where them all middle school girls?”

      Beamer4prez: (sits in corner, trying to decide between saving his turtle leader or watching Marcus Vick screw her while jerking off) “Damnit!! I’m going to have to go back to therapy again!”

      Ibleed: (To Beamer): “Come on Rafael, our leader Twolves needs our help! It's Twolves Juror Ninja Turtles time!”

      Beamer4prez: “Fuck you! I'm not Rafael! I told you I'm Leonardo!”

      Ibleed: “No fuck you! I'm Leonardo I called it first! And Twolves likes me best!”

      **ibleed pulls out cellphone**

      Bungerhole: “Jurors can't use phones in the court! Who the hell are you calling?”

      Ibleed: “I'm calling a billboard company! I need to put up a billboard so everybody remembers that I called Leonardo first and that Twolves is my MBA date!”

      **Michelin man enters room with doughnuts**

      Michelin man: “Jtrain, enjoy!!!”

      Bungertrain17: (runs towards the doughnuts) “YES!!!”

      Michelin man: “Bah, just wait. How many doughnuts can you eat ? You can’t out eat me!!!”

      Bungertrain17: “I’ll eat 21 more then you can in 2 minutes kiddo!!!”

      Michelin man: “That’s a lie”

      Bungertrain17: “Just watch me”

      **2 minutes later. Jtrain eats 10, Michelin man eats 17*

      Comment


      • #4
        Michelin man: “Hahahahahaha!!!”

        Bungertrain17: “Err, that was jtrain who said he could eat 21 more. Josh the person knew you would win”

        **drugged up man rises**
        Bellefay1: “Shut up you elitist fat bastard”

        38noles: “We call bellefay1 to the stand!!!!”

        bungertrain17: “Hey bitchboy, it’s my turn. Besides, mikey over here isn’t mentally fit to take the stand. (To bellefay1) Hey mikey show me that picture of a half naked Stanley McClover again, you faggot assed bitch??”

        silky_johnson: “Hey! I’ve got the perfect test to use. Mmm, let’s first test it out on a random person in the crowd before we use it on bellefay1”

        **silky spots random kid wearing a chef’s hat in the back**

        silky_johnson: “Hey you, come up here!!”

        Jerrell: “Me coooooook!!”

        **Jerrell writes test**

        silky_johnson: “Hmmm….7 out of 50”

        Everyone in unison: “HAHAHAHAHA”

        Jerrell: “Me cooooooook!!!”

        **Jerrell walks away**

        silky_johnson: “Alright bellefay, write it”

        **bellefay1 writes test**

        silky_johnson: “Very impressive. 46 out of 50”

        **skank at the back rises**

        Gameday: “Uh, I don’t think so. No way. He cheated and HR helped him do it they're cheaters!”

        Minimure and MMG in unison: “Yeah, whatever she said!! They cheated!!”

        Beowulf: “It's all a cheating conspiracy! Miami always cheats! The trial is rigged! But I don't care, I'm a Gameday fan anyway.”

        **Hurricane Reuben rises from back of courtroom**

        HurricaneReuben: “I did not cheat, I swear it on the good name of Miami Hurricane football”

        **HR reaches below his chair and picks up Michael Irvin autographed shotgun**

        **HR shoots Gameday**

        **Man rise from the back**

        reblgent: “Go Hokies!!”

        **HR shoots reblgent**

        HurricaneReuben: “Yeah fuck it, I cheated, what do you excpect? I'm a Miami fan”

        **Dirty old bum who looks suspiciously like Lamar Thomas re-enters courtroom**

        Dirty old bum: “Yeah bitch! You don't show up in the CR if you ain't ready to get shot! It’s all about the U baby!!”

        **Canesdude, TheU, readysetdominate rise and flash the [__]**

        **Michael Irvin enters courtroom**

        Michael Irvin: “That's not my shotgun! It belongs to my cousin! But whoever used it to shoot that bitch must have some black in the family, no white boy shoots like that!!”

        **Man rises**

        Cardfan: “I told you Miami would kill 2, I told you all season long they'd kill 2 people!”

        **timb enters room**

        Timb: “shit is out of hand!!”

        **timb takes reblgent’s wallet and leaves room**

        bungertrain17: “LMFAO @ Miami . Your honor, for our next witness we call….ColesLastStand!!!”

        Coleslaw: “Go Terps!!!”
        **minimure faints**
        bungertrain17: “Coleslaw, sherbs is innocent. Right??
        Coleslaw: (looks nervously at jtrain like his nervous nephews at the dinner table) “Yeah”
        **Big headed man rises**
        JohnKRaymond: “Hey shitface, that whore Sue just emo’d all over that dangerous shitheap”
        **Coles leaves the stand, jumps into his focus and rides off to NASA**
        bungerhole: “Okay, 38noles, your turn”
        38noles: “We call NashVol to the stand”
        NashVol: “About time you fucking monkeyhookers”
        38noles: “Any sexual encounters with sherbie?”
        NashVol: “No but I did let mascot feel up my zits while on break at Subway”
        **Jared from Subway enters room**
        Jared: (To jtrain) “Look at this man folks!! I used to be like this. Son, things can change.” (To NashVol) “Kevin, why of why did you leave me????”
        Bungertrain17: “Oh shove coon’s cock back up your ass you ignorant fuck”
        **jtrain grabs sub out of his hand and engulfs it**
        NashVol: “You want mayo on that? Here, let me squeeze a zit”
        38noles: “NashVol, is it true that you took sides when engaging in gossip with these women and thus backstabbing these young men??”
        Nashvol: (Scratches face) “Fuck you”
        38noles: “Is it true that your jealousy of these men and lack of e-sex made you turn to the bottle?”
        NashVol: (Pulls out a beer) “Fuck you”
        38noles: “You wanted to e-fuck sherbie, admit it!!!”
        NashVol: (Pulls out another beer) “She wanted to nibble on my zit OKAY!! I admit it!!”
        38noles: “Thank you”
        MrMichiganGuy: “mmmm, Ritz”
        Bungerhole: “Who do you call Joshua?”
        Bungertrain17: “We call mississippitiger33”
        Mt33: (gnaws on the microphone) “I love fat women”
        Bungertrain17: “Sorry soonerbrat isn’t here….yet”
        MT33: “I love girls, but not as much as I love rocks”
        **mt picks up rock and rubs it against his chest**
        Bungertrain17: “Tell us about the women here. They are caring, respectable girls right??”
        Mt33: “Yes. I love these girls more then I love transferring schools”
        **Baylor Bear mascot enters room**
        Baylor Bear: “We are Baylor!!”
        **Some guy wearing a corndog costume enters room**
        Corndog guy: “I want sex!!”
        Skelsa: “Let’s roll baby!!”
        **Mt33 runs to the corner of the CR and cries**
        **COONASSDH glares at mt33 while on hold on the phone booking a Greyhound ticket**
        Bungertrain17: “There’s no way skelsa got rammer jammered at her own house, right?”
        Rolltide: “HAHAHAHA”
        Mt33: “She’s mine!!! I love her!!”
        LSUBlondie: “I like thought, you like, liked me?”
        **Ladd with multiple scars on his face enters room on crutches**
        Pawprint: “Hey sweetie!!” **icon smilie**
        Abercrombiefish: “Hey backup. Don’t make me throw water at you”
        Pawprint: “Back off, shes mine”
        LSUBlondie: “Sorry I like totally don’t like date guys with like names like Ladd”
        **COONASS’s cousin enters room**
        **pawprint pisses his pants, pulls out a white handkerchief and waves it**
        Bungertrain17: “LMFAO at all of these jtrained fucks!!!”
        **HerbieHusker enters room**
        Orlandosooner: “Oooohhhh, a big toy!!”
        Str8eastcoastin: “LMFAO at this pathetic ass gooner fuck”
        **timb enters room**
        Timb: “Str8, you’re banished. Shit is still out of hand!!!”
        **timb leaves room**
        **Barry Switzer enters room**
        Barry: “Anyone seen my son?”
        Orlandosooner: “Oh crap!!”
        Barry: “Damnit son!!! You’re coming with me!!!!”
        silky_johnson: “LMFAO at that jackass Herbie”
        **MarineHusker e-murders silky with a lawnmower blade**
        MrMichiganGuy: “Mmm, I love ritz”
        Charlie Weis: “I’m sitting here enjoying the trial while they’re sitting up there eating cheeseburgers and getting e-murdered. Shit! Fuck! Shit!”
        MarineHusker: “Sorry Charlie….I don’t e-murder people who are recovering from Gastric Bypass surgery or else I’d have to kill Melody too”
        Bungerhole: “38noles, you are up”
        38noles: “We call soonerbrat to the stand!! Brat, have you ever engaged in any sexual activities with anyone on this board?”
        soonerbrat: “Yes. Timb fucked me”
        **timb enters room**
        Timb: “I did not have sexual relations with that man”
        Soonerbrat: “I’d say, it’s not like a 2 second pump can be classified as sex”
        Timb: “shit is out of hand!! You are banished from the CR!!!!”
        Bungertrain17: “LMFAO at that fat ugly bitch”
        Bungerhole: “ENOUGH!!! Josh, I’ll give you 1 last witness before this trial is over”
        Bungertrain17: “We call that pasty white boy CuseOrange to the stand”
        CuseOrange (Smiles at sherbs) “Hey”
        Sherbie: “Hey scooter”
        **Hawksgirl’s face turns beat red**
        Bungertrain17: “Cuse, sherbie is an innocent young victim here, correct?”
        Cuse: “Absolutely, I only e-fucked her 324 times!!”
        Bungertrain17: “For fuck sakes!!”
        Hawksgirl: “I’m going to kill you!!!!”
        Sherbie: (Hides behind jcole) “Hooooooooooooooos going to hurt me now!!”
        **Kbnole rises and e-punches jcole in the face**
        **ibleed pulls out his badass turtle sword and lunges at kbnole**
        **Kane enters room**
        Kane: “You turtles aren’t made of the same shell as me”
        Bungerhole: “GENO!!! Again??”
        **beamer and twolves pull out their badass turtle weapons and surround GENO and kbnole**
        **GENO e-murders the turtles and kbnole**
        **timb enters room**
        Timb: “Shit is out of hand!! GENO, be gone!!”

        Comment


        • #5
          Bungerhole: “ENOUGH!!!!!!!!!!!!! Some of you are so fucking immature. For fuck sakes!!! I’ll be back in 2 minutes with my decision”
          **2 minutes later **
          ** User load exceeded maximum query load 50000**
          **15 minutes later**
          ** User load exceeded maximum query load 50000**
          **15 minutes later**
          ** User load exceeded maximum query load 50000**
          **15 minutes later**
          ** User load exceeded maximum query load 50000**
          **15 minutes later bungerhole returns with a Superman costume on**
          Bungerhole: “Sorry about that guys”
          **Skelsa and Corndog guy enter room**
          Skelsa: “I just got knocked up for the 2nd time!!”
          Crowd in unison: “Who’s your daddy!! Who’s your daddy!!”
          **Corndog guy pulls off mask to reveal Johnny Stallings**
          Johnny: “Durrrr, she played with my yeller hammer, durrr!!!!”
          Rolltide: “Skelsa!! I thought I was the only retard from Alabama in your life!!!”
          **MT kills himself**
          **rolltide and COONASSDH leave room in tears**
          **COONASSDH boards bus to Virginia and rolltide hops on motorcycle**
          **Bag of Golden Flake Potato chips falls out of RTs helmet into his eyes, RT crashes head on into bus. There is a huge explosion. Camera zooms in on the corpses**
          Potsy: “The Horror!! The Horror!!”
          **Potsy kills himself**
          **Back to the courtroom**
          **Beowulf rises with man boobs hanging from a t-shirt that says Gameday fan**
          Beowulf: “This whole thing is fixed! But, I don’t care because…”
          Everyone in unison: “Shut the fuck up whiner!!”
          Bungertrain17: “LMFAO at Bryce. Your mother hated you so much, she named you Bryce. HAHAHAHAHAHAHAHA”
          Bungerhole: “I’ve reached a decision. After much thought, I think sherbie is a complete slut!! The defendants are innocent!!!!”
          **38noles and his defendants celebrate**
          **5 minutes later**
          **Man wearing a striped black and white shirt enters room and throws something at bungerhole**
          Bungerhole: “Ahhhh!!! It’s kryptonite!!”
          **Bungerhole runs out of the CR**
          **Striped man picks up the bogus kryptonite and puts it in his back pocket**
          Striped man: “Hello!!! My name is Terry Porter.”
          Bungertrain17: “HAHAHAHAHAHAHAHAHAHAHAHAHAHAH”
          Terry Porter: (Makes dumbass arm movement) “Judicial interference on the judge”
          Terry Porter: “Sherbie is innocent!!! I deem the defendants guilty!!!
          CanesFanDan: “This isn’t fair!!! Sherbie won the trial but, really who cares. I love American Idol!!!”
          osunatlchumps: “LMFAO at the self deluded plaintiff jackass nation”
          MrMichiganGuy: “This isn’t fair!! I want a retrial!! The defendants deserve a retrial in a neutral courtroom!!!”
          Skelsa: “That kryptonite was bogus”
          Gyle: “Shut up and let me gamecock you”
          Skelsa: “I’m sooooo going to give you my fake location and make you Greyhound over there”
          Gyle: “I can’t wait to run that shit up!!”
          Worldofx: “Any HS boy wanna cyber fo shizzle??”
          Secman: “War damn penis!!”
          MrMichiganGuy: “Hey skelsa, want some ritz baby?”
          Gator: “Wanna meet up in Atlanta skelsa??”
          **sherbie starts stripping**
          **silky_johnson returns from the dead**
          silky_johnson: “Guys, guys guys. Have we not learned anything today?? The moral of the story is, all girls posting on a football message board are complete sluts”
          **MH e-murders silky again**
          The End
          After the trial nothing was learned: sherbs moved in with jcole, brat continued to show boobie pictures, and skelsa continues to hit on posters.
          Don’t let these skanks get to you.
          Written by: silky_johnson, secman, and Gyle.
          Produced by: Microsoft Word (Fuck you Bill Gates!!)
          Banned by(likely) : Timb, Bungi, or MarineHusker
          Sued by: sherbie, skelsa, and any other lying e-slut

          Comment


          • #6
            You know, I've still never read this. I've looked at parts of it, but I've yet to read this thing from start to finish.

            Comment


            • #7
              LMFAO. Glory Days.


              Totally forgot about Wolvie up in your Pie Jerrell and the Wonderlic and MH getting batshit ANGRY over everything.

              If only I'd managed to keep the Oregon replay official on as judge a bit longer.

              Comment


              • #8
                LMFAO....

                The pinnacle of message board posting.

                Comment


                • #9
                  You losers

                  Comment


                  • #10
                    you cumstains were in what, your late teens, early twenties and were message board "trial by conviction" on a late night instead of getting laid? Hmmmm.....I'm really disturbed at this point.

                    Comment


                    • #11
                      Still my finest moment in a court of law.

                      Comment


                      • #12
                        JTrain pissed excellence in the trial.

                        Comment


                        • #13
                          I never knew my name was in this...

                          Comment


                          • #14
                            Originally posted by Fresneck View Post
                            I never knew my name was in this...
                            I'm sure we tried to cover almost every active poster at the time (CFBMedia)

                            Comment


                            • #15
                              Originally posted by silky_johnson View Post

                              I'm sure we tried to cover almost every active poster at the time (CFBMedia)
                              Yeah you guys forgot about me and fresnoid......

                              Comment

                              Working...
                              X